Last month, a study from Israel made waves claiming Pfizer vaccine mRNA persists in blood, placenta, sperm and seminal fluid - still detectable in 50% of women over 200 days after their last dose.
Even stranger: they claimed to find it in 3 of 6 unvaccinated pregnant women.
Then the study vanished - not retracted, just deleted.
I decided to check their primers. What I found illustrates a fundamental challenge with PCR and the so-called human genome…
TL;DR: The study used faulty primers that match the human genome, so they detected human DNA instead of vaccine mRNA - that’s why 50% of unvaccinated people tested “positive”.
All details below:
Analysis of the Deleted Mordechay et al. Study on Vaccine mRNA Detection
The Study’s Claim
A study published in October 2025 claimed to detect Pfizer vaccine mRNA in blood, placenta, and semen of vaccinated individuals - and remarkably, in 50% of unvaccinated women too. The study was completely deleted (not retracted) shortly after publication.
I analyzed their primer sequences against the human genome. Here’s what I found.
The Primers: 8 Out of 12 Were Unusable
The researchers designed 12 PCR primers to detect “vaccine-specific” sequences:
The authors admitted the UTR primers gave “non-specific amplification” - because Pfizer used human gene sequences for the vaccine’s regulatory regions. Only the 4 spike-region primers were used.
The Problem: Those 4 “Vaccine-Specific” Primers Match the Human Genome
I BLASTed all 4 primers against the human reference genome (GRCh38.p14):
The nested forward primer is a PERFECT match to human chromosome 1.
Why This Matters for PCR
The study used nested PCR - two rounds of amplification:
- Round 1: Outer primers (20 cycles)
- Round 2: Nested primers (30 cycles) - generates the final product
With 50 total cycles and primers that match human DNA:
- The nested forward primer (100% human match) will bind human DNA
- The 18/20 matches (90%) can still bind - PCR tolerates 1-2 mismatches, especially at the 5’ end
- Any human sample could potentially give a “positive” result
The Unvaccinated Results Make Sense Now
From the study’s own data:
The detection rate in vaccinated people drops to the same level as unvaccinated over time. This suggests the ~50% “baseline” is likely assay noise from human DNA cross-reactivity, not vaccine mRNA.
3 of 6 unvaccinated women tested “positive” - exactly what you’d expect if the primers are amplifying human sequences.
Conclusion
The study’s “vaccine-specific” primers are not vaccine-specific at all:
- 1 primer perfectly matches human chromosome 1
- 3 primers match human DNA at 18/20 bases (sufficient for PCR binding)
- The 50% positive rate in unvaccinated people likely reflects human DNA amplification, not vaccine detection
This is a fundamental primer design flaw that should have been caught by:
1. The researchers (basic BLAST check before experiments)
2. Peer reviewers
3. The journal editors
Why Deleted Instead of Retracted?
Speculation:
- Retraction requires a formal process - investigation, author response, public record
- Deletion leaves no trace - no DOI, no retraction notice, no explanation
- The flaw is so fundamental (primers match human genome) that it’s not a “mistake” that can be corrected - the entire study is invalid
- A retraction notice explaining “our vaccine-specific primers match human DNA” would be embarrassing and quotable
- Deletion allows the journal and authors to pretend it never happened
TL;DR
Researchers claimed to find vaccine mRNA in 50% of unvaccinated people. Their “vaccine-specific” detection method uses primers that match the human genome - including one perfect 20/20 match to chromosome 1. They were likely detecting human DNA, not vaccine mRNA. The study was deleted rather than retracted, leaving no public record of what went wrong.
---
Technical Details
BLAST Results Against GRCh38.p14
**Primer 1 - `CGTGATCCGGGGAGATGAAG` (1254 F outer):**
- NC_000016.10 (Chromosome 16), position 6,834,975-6,834,994: 90% identity (18/20, 2 mismatches)
**Primer 2 - `ACTTCACCGGCTGTGTGATT` (1337 F nested):**
- NC_000001.11 (Chromosome 1), position 33,048,488-33,048,507: **100% identity (20/20, 0 mismatches)**
**Primer 3 - `TGCTGGAATGGCAGGAACTT` (1745 R nested):**
- NC_000012.12 (Chromosome 12), position 55,432,051-55,432,070: 90% identity (18/20, 2 mismatches)
**Primer 4 - `GGGATCTCTAACGGCGTCTG` (1791 R outer):**
- NC_000003.12 (Chromosome 3), position 187,273,415-187,273,434: 90% identity (18/20, 2 mismatches)
Study Reference
Mordechay L, Baum G, Gabbay-Benziv R, Weinberger H, Morgenstern MF. (2025). Detection of Pfizer BioNTech Messenger RNA COVID-19 Vaccine in Human Blood, Placenta and Semen. Ann Case Rep 10: 2428. DOI: 10.29011/2574-7754.102428
Archived version: https://web.archive.org/web/20251205172931/https:/www.gavinpublishers.com/assets/articles_pdf/Detection-of-Pfizer-BioNTech-Messenger-RNA-COVID-19-Vaccine-in-Human-Blood-Placenta-and-Semen.pdf





Thanks for updating. Nicholas Hulscher needs to correct the record.
Tricky? How about downright fake, corrupt and useless. How can a rock test positive using PCR for covid or any of the other fake viruses? Perhaps the human genome is a fake-out also...which I happen to believe.